View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12403_high_5 (Length: 273)
Name: NF12403_high_5
Description: NF12403
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12403_high_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 258
Target Start/End: Complemental strand, 45550344 - 45550105
Alignment:
| Q |
19 |
tctgaggtggttggaataaaagcattgaagggctttgacaaggccagcatcatcaactattctgctcgtcaaaattatgttgaggtgatgatgggaagga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45550344 |
tctgaggtggttggaataaaagcattgaagggctttgacaaggccagcatcatcaactattctgctcgtcaaaattatgttgaggtgctgatgggaagga |
45550245 |
T |
|
| Q |
119 |
aacaggatcacccacataacagtggcacagtaaaggatagaagcataaatggcaatgatccatttcataatctaaataacatgcacgaaagaagatcaca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45550244 |
aacaggatcacccacataacagtggcacagtaaaggacagaagcataaatggcaatgatccatttcataatctaaataacatgcacgaaagaagatcaca |
45550145 |
T |
|
| Q |
219 |
agttaaacctgccattcaaattgcaaaggaaggacaaaca |
258 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45550144 |
agttaaacctgccattcaaattgcaaaagaaggacaaaca |
45550105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University