View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12407_high_2 (Length: 361)
Name: NF12407_high_2
Description: NF12407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12407_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 18 - 193
Target Start/End: Complemental strand, 2652585 - 2652409
Alignment:
| Q |
18 |
agacttttaccaagttgacca-gatacttattttcttgctctttgaaagtacaatcacgaccatattgaatcaaatagtcctggattatgcattcatatg |
116 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2652585 |
agacttttaccaagttgaccaagatacttattttcttgctctttgaaagtacaatcacgaccatattgaatcaaatagtcctggattatgcattcatatg |
2652486 |
T |
|
| Q |
117 |
agaagaagttcataccccatcaaacaaatgagtgtaaaattcaatgtagttataacacatatatcaaaaaaccaaat |
193 |
Q |
| |
|
||||||||||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2652485 |
agaagaagttcatcccccattaaacaaatgaatgtaaaattcaatgtagttataacacatatatcaaaaaaccaaat |
2652409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 245 - 338
Target Start/End: Complemental strand, 2652403 - 2652310
Alignment:
| Q |
245 |
tttttccttccctgatcgaaacatcgactttggtgtcggttgggacatttgcgattgtcttaaaatactaagtgaatcatcaactggactataa |
338 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
2652403 |
tttttccttccctgatcgaaacatcgactttggtgtcggttgggacatttgcgattgtcttaaaatactaagtaaatcatcaattggactataa |
2652310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University