View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12407_high_4 (Length: 242)
Name: NF12407_high_4
Description: NF12407
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12407_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 111
Target Start/End: Complemental strand, 47904997 - 47904887
Alignment:
| Q |
1 |
tcttcaaatattttagggtctctctcatatcattgcttattcgtctgttggcccataacatgttaaaggtgagaaaaacacaagggggttgaattatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47904997 |
tcttcaaatattttagggtctctctcatatcattgcttgtttgtctgtcggcccataacatgttaaaggtaagaaaaacacaagggggttgaattatgta |
47904898 |
T |
|
| Q |
101 |
ggttttgtctg |
111 |
Q |
| |
|
||||||||||| |
|
|
| T |
47904897 |
ggttttgtctg |
47904887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 149 - 224
Target Start/End: Complemental strand, 47904865 - 47904790
Alignment:
| Q |
149 |
gttaaaaaccaattagaggatgcaaaagataatccgagaagatagaagagaatgacaaggatatttatcctattca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47904865 |
gttaaaaaccaattagaggatgcaaaagataatctgagaagatagaagagaatgacaaggatatttatcctattca |
47904790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 66 - 100
Target Start/End: Complemental strand, 18821389 - 18821355
Alignment:
| Q |
66 |
aaggtgagaaaaacacaagggggttgaattatgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
18821389 |
aaggtgagaaaaacacaagggggttgaattgtgta |
18821355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University