View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12408_low_2 (Length: 247)
Name: NF12408_low_2
Description: NF12408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12408_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 74 - 232
Target Start/End: Complemental strand, 7498968 - 7498810
Alignment:
| Q |
74 |
ttcataaagttataactttaactaataatgaaattatgatatggtcactgaccctggtcaaattcaccatgagaaatccaatgttgttactcttcaatcg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7498968 |
ttcataaagttataactttaactaataatgaaattatgatatggtcactgaccctggtcaaattcaccatgagaaatccaatgttgttactcttcaatcg |
7498869 |
T |
|
| Q |
174 |
ttttagttgctttttggtgactgtcgaggtccaaccataacaattttcgaagtcatggt |
232 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7498868 |
ttttagttgctttttggtgactgttgaggtccaaccataacaattttcgaagtcatggt |
7498810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University