View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12409_high_2 (Length: 408)
Name: NF12409_high_2
Description: NF12409
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12409_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 263; Significance: 1e-146; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 125 - 395
Target Start/End: Complemental strand, 10539538 - 10539268
Alignment:
| Q |
125 |
ttttgatttgtgatgatatggtagttttatttgcattattaatatatctaacacttttattatgaaggcgtgtccaagtatctggcatgtatcgatgtct |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10539538 |
ttttgatttgtgatgatatggtagttttatttgcattattaatatatctaacacttttattatgaaggcgtgttcaagtatctggcatgtatcgatgtct |
10539439 |
T |
 |
| Q |
225 |
atttttctaatagatgtgattataccatcacttttatcttttaaaatcattacatgtgtttatttgttcatatcgtgtttgcgttggtgcttcattcatg |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10539438 |
atttttctaatagatgtgattataccatcacttttatcttttaaaatcattacatgtgtttatttgttcatatcgtgtttgcgttggtgcttcattcatg |
10539339 |
T |
 |
| Q |
325 |
ctatatcatggggttggtttacaaataggatggagaaaaatccgggtgtgaaattttatgattgttggtct |
395 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10539338 |
ctatatcatggggttggtttacagataggatggagaaaaatccgggtgtgaaattttatgattgttggtct |
10539268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 19 - 100
Target Start/End: Complemental strand, 10539609 - 10539528
Alignment:
| Q |
19 |
gttttgttttatgttttgggtaccattttaacaattaggtatttgattgatgcagaacaagttactgataattttgatttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10539609 |
gttttgttttatgttttgggtaccattttaacaattaggtatttgattgatgcagaacaagttactggtaattttgatttgt |
10539528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University