View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_high_18 (Length: 431)
Name: NF1240_high_18
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_high_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 1 - 403
Target Start/End: Original strand, 783032 - 783434
Alignment:
| Q |
1 |
atgtaacattggtattttggtgggtagattatactctcgcgttcttctttacacgtacagactaccatatttagttgctaatgttagaacatttcccgta |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783032 |
atgtaacattggtattttggtggcattattatattctcgtgttcttctttacacgtacagattaccatatttagttgctaatgttagaacatttcccgta |
783131 |
T |
 |
| Q |
101 |
gtaatagtaacttacttattgagcattgttgcatatcgatgttggagcttaattcatttggtggcaggtttcatatgggatattagagaaagtgtcacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783132 |
gtaatagtaacttacttattgagcattgttgcatatcgatgttggagcttaattcatttggtggcaggtttcatatgggatattagagaaagtgtcacct |
783231 |
T |
 |
| Q |
201 |
gtgacacactcagtcggaaattgtgttaagcgtgtcgttgtcatcgtctcttctgttatcttcttccaaactcctgtctcacctatcaatgcccttggta |
300 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783232 |
gtgacacactcagtcggaaattgcgttaagcgtgtcgttgtcatcgtctcttctgttatcttcttccaaactcctgtctcacctatcaatgcccttggta |
783331 |
T |
 |
| Q |
301 |
agtctctctaatggtccacatattttcaagtacttgcaaatttttggtgtcttcgaagtcacaaaaattgctacaacttatgggaccatttactatccat |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
783332 |
agtctctctaatggtccacatattttcaagtacttgcaaatttttggtgtcttcgaagtcacaaaaattgctacaacttatgggaccatttactatccat |
783431 |
T |
 |
| Q |
401 |
att |
403 |
Q |
| |
|
||| |
|
|
| T |
783432 |
att |
783434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University