View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1240_high_27 (Length: 367)

Name: NF1240_high_27
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1240_high_27
NF1240_high_27
[»] chr8 (1 HSPs)
chr8 (275-339)||(3001509-3001573)


Alignment Details
Target: chr8 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 275 - 339
Target Start/End: Original strand, 3001509 - 3001573
Alignment:
275 ttttcattgagataatattatattggtcttatggacgatattgtattattattgatgcaacatgt 339  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
3001509 ttttcattgagataatattatattggtcttatggacgatattatattattattgatgcaacatgt 3001573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University