View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_high_28 (Length: 361)
Name: NF1240_high_28
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_high_28 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 95 - 361
Target Start/End: Complemental strand, 33721148 - 33720882
Alignment:
| Q |
95 |
atgattcctatcataattctattaatttatcaaagattgctactccatatactttcatttctatgctaatctatagcactaattagaggaagaaagctgg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33721148 |
atgattcctatcataattctattaatttatcaaagattgctactccatatactttcatttctatgctaatctatagcactaattagaggaagaaagctgg |
33721049 |
T |
 |
| Q |
195 |
ttagctgagaaactagagttgagagacaacattacactatatctctggtttggaggattgctcatgtttgaatgctttgttgaatcgtgaaggtagatga |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33721048 |
ttagctgagaaactagagttgagagacaacattacactatatctctggtttggaggattgctcatgtttgaatgctttgttgaatcgtgaaggtagataa |
33720949 |
T |
 |
| Q |
295 |
ttcaaagacaagattccttcttaaaacgtcaatacatgtgtcattagcagcatatgcagcagtattc |
361 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33720948 |
ttgaaagacaagattccttcttaaaacgtcaatacatgtgtcattagcagcatatgcagcagtattc |
33720882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 98 - 184
Target Start/End: Complemental strand, 21219624 - 21219536
Alignment:
| Q |
98 |
attcctatcataattctattaatttatcaaagattgctac--tccatatactttcatttctatgctaatctatagcactaattagagga |
184 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |||| | ||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
21219624 |
attcctatcataattctattactttatcaaagattgctacaaagcatacattttcatttctaggctaatctatagcaataattagagga |
21219536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 295 - 361
Target Start/End: Original strand, 4060666 - 4060732
Alignment:
| Q |
295 |
ttcaaagacaagattccttcttaaaacgtcaatacatgtgtcattagcagcatatgcagcagtattc |
361 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4060666 |
ttcaaagacaagattccttctcaaaacgtctatacttgtgtcattagcagcatatgcagcagtattc |
4060732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 97 - 133
Target Start/End: Original strand, 21657497 - 21657533
Alignment:
| Q |
97 |
gattcctatcataattctattaatttatcaaagattg |
133 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
21657497 |
gattcctatcacaattctattattttatcaaagattg |
21657533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University