View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_22 (Length: 425)
Name: NF1240_low_22
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_22 |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 313; Significance: 1e-176; HSPs: 20)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 30 - 418
Target Start/End: Original strand, 26717701 - 26718090
Alignment:
| Q |
30 |
tcctgaacgatgtatcctaacataattggttttcaatggtggaaggaagataaaaacaagtttctttgtttttagaggtgtaaaacaatggctttaattg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26717701 |
tcctgaacgatgtatcctaacataattggttttcaatggtggaaggaagataaaaacaagtttctttgtttttagaggtgtaaaacaatggctttaattg |
26717800 |
T |
 |
| Q |
130 |
cttagctcttgtcttggaacac--aataaaaactcgtaagtttgaacttttaccaatccaagtgataaaaaatgcaattttttctcttcttaagacttga |
227 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26717801 |
cgtagctcttgtcttggaacacaaaataaaaactcgtaagtttgaacttttaccaatccaagtgataaaaaatgcaattttttctcttgttaagacttga |
26717900 |
T |
 |
| Q |
228 |
aaggtttta-nnnnnnngtggtggtcagagtttgaaccctgaaccttgcatatattatgcattattagttatcactaccaactgagttaagctcacgaga |
326 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26717901 |
aaggttttattttttttgtggtggtcagagtttgaaccctggaccttgcatatattatgcattattagttatcactaccaactgagttaaactcacgaga |
26718000 |
T |
 |
| Q |
327 |
atacttgaaatgttttattaattccagatggatagttttggactagaaaatgttttaagaataataactctatcgtagtagtcttcatctca |
418 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26718001 |
acacttgaaatgttttattaattccagatggatagtttcggactagaaaacgttttaagaataataa--ctatcgtagtagtcttcatctca |
26718090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 18023750 - 18023705
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18023750 |
gtggtggtcggagtttgaaccctggaccttgcatatattatgcatt |
18023705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 285
Target Start/End: Complemental strand, 32315294 - 32315253
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatg |
285 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
32315294 |
gtggtggtcagggttcgaaccctgaaccttgcatatattatg |
32315253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 285
Target Start/End: Original strand, 45046205 - 45046246
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatg |
285 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
45046205 |
gtggtggtcagagtttgaaccccggaccttgcatatattatg |
45046246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 244 - 292
Target Start/End: Original strand, 22564132 - 22564180
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||| | |||||| |
|
|
| T |
22564132 |
gtggtggtcagagtttgaaccttgaactttgcatatattacgtattatt |
22564180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 256 - 291
Target Start/End: Complemental strand, 4047844 - 4047809
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4047844 |
gtttaaaccctgaaccttgcatatattatgcattat |
4047809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 244 - 291
Target Start/End: Complemental strand, 46371052 - 46371005
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||||||| |||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
46371052 |
gtggtggtcggagtttgaaccccggaccttggatatattatgcattat |
46371005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 256 - 324
Target Start/End: Complemental strand, 10242539 - 10242479
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcattattagttatcactaccaactgagttaagctcacga |
324 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10242539 |
gtttgaaccctggaccttgcatatattatgcat------ttat--ctaccaactgagttaagctcacga |
10242479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 245 - 291
Target Start/End: Original strand, 26529682 - 26529728
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
|||||||| | |||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
26529682 |
tggtggtcggggtttaaaccccgaaccttgcatatattatgcattat |
26529728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 247 - 289
Target Start/End: Original strand, 34448603 - 34448645
Alignment:
| Q |
247 |
gtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| |||||||||||| ||||| ||||||||||||||| |
|
|
| T |
34448603 |
gtggtcagggtttgaaccctggaccttacatatattatgcatt |
34448645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 3830127 - 3830094
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
3830127 |
gtttgaaccctggaccttgcatatattatgcatt |
3830094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 248 - 285
Target Start/End: Complemental strand, 5082371 - 5082334
Alignment:
| Q |
248 |
tggtcagagtttgaaccctgaaccttgcatatattatg |
285 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
5082371 |
tggtcagagtttgaactcagaaccttgcatatattatg |
5082334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 21751616 - 21751661
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
21751616 |
gtggtggtcagagtttgaaacccaaatcttgcatatattatgcatt |
21751661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 29926398 - 29926443
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| |||||||||||||||| || |||||||||| ||||||| |
|
|
| T |
29926398 |
gtggtggccagagtttgaaccctggacattgcatatatcatgcatt |
29926443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 33473511 - 33473556
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| ||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
33473511 |
gtggtggccagggttggaaccctggaccttgcatatattatgcatt |
33473556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 289
Target Start/End: Original strand, 39280816 - 39280853
Alignment:
| Q |
252 |
cagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
39280816 |
cagagtttgaaccccggaccttgcatatattatgcatt |
39280853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 42227795 - 42227840
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
42227795 |
gtggtggtcggagtttgaacctcgaaccttacatatattatgcatt |
42227840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 285
Target Start/End: Original strand, 47607900 - 47607941
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatg |
285 |
Q |
| |
|
||||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
47607900 |
gtggtggccggagtttgaaccctggaccttgcatatattatg |
47607941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 244 - 284
Target Start/End: Original strand, 21327531 - 21327571
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattat |
284 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
21327531 |
gtggtggtcggagtttgaaccccaaaccttgcatatattat |
21327571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 244 - 284
Target Start/End: Complemental strand, 30081944 - 30081904
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattat |
284 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
30081944 |
gtggtggtcaggatttgaaccctgaaccttacatatattat |
30081904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000003; HSPs: 18)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 21029356 - 21029401
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
21029356 |
gtggtggtcagaatttgaaccccgaaccttgcatatattatgcatt |
21029401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 244 - 291
Target Start/End: Complemental strand, 29680659 - 29680612
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||||||| |||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
29680659 |
gtggtggtcggagtttgaacaccgaaccttgcatatattatgcattat |
29680612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 12323480 - 12323525
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | ||||||||||||||||||| |||||||||||||| |
|
|
| T |
12323480 |
gtggtggtcggtgtttgaaccctgaaccttgtatatattatgcatt |
12323525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 33542798 - 33542842
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
33542798 |
tggtggtcggagtttgaactatgaaccttgcatatattatgcatt |
33542842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 244 - 291
Target Start/End: Complemental strand, 9977128 - 9977081
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
9977128 |
gtggtggtcagggtttgaaccccagaccttgcatatattatgcattat |
9977081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 244 - 291
Target Start/End: Complemental strand, 10018470 - 10018423
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||||| | |||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
10018470 |
gtggtggccggagtttgaaccccgaaccttacatatattatgcattat |
10018423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 254 - 289
Target Start/End: Original strand, 26356081 - 26356116
Alignment:
| Q |
254 |
gagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26356081 |
gagtttgaaccccgaaccttgcatatattatgcatt |
26356116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 788937 - 788892
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||| | ||||||||||||||||||||||| |
|
|
| T |
788937 |
gtggtggtcggggtttgaactccgaaccttgcatatattatgcatt |
788892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 8629698 - 8629731
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
8629698 |
gtttgaaccccgaaccttgcatatattatgcatt |
8629731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 255 - 292
Target Start/End: Original strand, 12459742 - 12459779
Alignment:
| Q |
255 |
agtttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
12459742 |
agtttgaaccccgaaccttacatatattatgcattatt |
12459779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 15170002 - 15169957
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
15170002 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcatt |
15169957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 15178774 - 15178729
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
15178774 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcatt |
15178729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 18253341 - 18253374
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
18253341 |
gtttgaaccctggaccttgcatatattatgcatt |
18253374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 24623307 - 24623352
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||| ||||||| ||||||||||||||| |
|
|
| T |
24623307 |
gtggtggtcggggtttgaaccccgaaccttacatatattatgcatt |
24623352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 29283886 - 29283841
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||| |||| |
|
|
| T |
29283886 |
gtggtggtcggagtttgaaccctagaccttgcatatattatacatt |
29283841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 256 - 288
Target Start/End: Original strand, 866287 - 866319
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcat |
288 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
866287 |
gtttgaaccatgaaccttgcatatattatgcat |
866319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 23903298 - 23903342
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| | |||||||||| |||| |||||||||||||||||| |
|
|
| T |
23903298 |
tggtggtcggtgtttgaaccccgaacgttgcatatattatgcatt |
23903342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 289
Target Start/End: Complemental strand, 32053858 - 32053814
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32053858 |
tggtggccggagtttgaaccacgaaccttgcatatattatgcatt |
32053814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000003; HSPs: 29)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 24579658 - 24579703
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24579658 |
gtggtggccagagtttgaaccctggaccttgcatatattatgcatt |
24579703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 38904132 - 38904087
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
38904132 |
gtggtggttagggtttgaaccctgaaccttgcatatattatgcatt |
38904087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 244 - 329
Target Start/End: Original strand, 31815877 - 31815955
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattattagttatcactaccaactgagttaagctcacgagaata |
329 |
Q |
| |
|
||||||||| | |||||||||| | ||||||||||||||||||| || || ||||||||||||||||||||||||||||| |
|
|
| T |
31815877 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgca-------ttgtccctaccaactgagttaagctcacgagaata |
31815955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 247 - 289
Target Start/End: Complemental strand, 33866956 - 33866914
Alignment:
| Q |
247 |
gtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
33866956 |
gtggtcagagtttgaactctgaaccttgcatattttatgcatt |
33866914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 11560557 - 11560524
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11560557 |
gtttgaaccctgaaccttgcatatattatgcatt |
11560524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 20990894 - 20990939
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| ||||||||| |
|
|
| T |
20990894 |
gtggtggtcggggtttgaaccctgaaccttgcatattttatgcatt |
20990939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 23250310 - 23250355
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
23250310 |
gtggtggtcggggtttgaaccctggaccttgcatatattatgcatt |
23250355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 660813 - 660857
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| | |||||||||||| ||||||||||||||||||||| |
|
|
| T |
660813 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcatt |
660857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 244 - 284
Target Start/End: Complemental strand, 18290723 - 18290683
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattat |
284 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
18290723 |
gtggtggtcggagtttgaaccccgaaccttgcatatattat |
18290683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 244 - 288
Target Start/End: Complemental strand, 37852081 - 37852037
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcat |
288 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||||||||| |
|
|
| T |
37852081 |
gtggtggttagggtttgaaccctggaccttgcatatattatgcat |
37852037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 256 - 291
Target Start/End: Original strand, 5168581 - 5168616
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5168581 |
gtttgaaccccgaaccttgcatatattatgcattat |
5168616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 254 - 289
Target Start/End: Complemental strand, 9384796 - 9384761
Alignment:
| Q |
254 |
gagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9384796 |
gagtttgaaccctgaaccttacatatattatgcatt |
9384761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 254 - 289
Target Start/End: Complemental strand, 32458363 - 32458328
Alignment:
| Q |
254 |
gagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32458363 |
gagtttgaaccctggaccttgcatatattatgcatt |
32458328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 244 - 291
Target Start/End: Original strand, 36264469 - 36264516
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||||||| | |||||||||| |||| |||||||||||||||||||| |
|
|
| T |
36264469 |
gtggtggtcggggtttgaaccccgaactttgcatatattatgcattat |
36264516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 244 - 325
Target Start/End: Complemental strand, 43067737 - 43067663
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattattagttatcactaccaactgagttaagctcacgag |
325 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
43067737 |
gtggtggtcagggtttgaaccccgaacattgcatatgttattcattatt-------cctaccaactgagttaagctcacgag |
43067663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 247 - 292
Target Start/End: Original strand, 346117 - 346162
Alignment:
| Q |
247 |
gtggtcagagtttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
|||||| | |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
346117 |
gtggtcggggtttgaaccctggaccttacatatattatgcattatt |
346162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 4238830 - 4238785
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| ||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
4238830 |
gtggtggtcggagttcgaaccccgaaccttacatatattatgcatt |
4238785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 4897614 - 4897569
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| ||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
4897614 |
gtggtggccagggtttgaaccataaaccttgcatatattatgcatt |
4897569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 4945008 - 4944963
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| ||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
4945008 |
gtggtggccagggtttgaaccataaaccttgcatatattatgcatt |
4944963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 9547399 - 9547444
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
9547399 |
gtggtggtcggggtttgaaccccaaaccttgcatatattatgcatt |
9547444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 20200764 - 20200731
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
20200764 |
gtttgaaccctggaccttgcatatattatgcatt |
20200731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 23407008 - 23407053
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
23407008 |
gtggtggtcagggtttgaaccccagaccttgcatatattatgcatt |
23407053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 24581007 - 24581052
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
24581007 |
gtggtggtcggggtttgaacctcgaaccttgcatatattatgcatt |
24581052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 25395432 - 25395477
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||| |||||||||||||||||||||||| |
|
|
| T |
25395432 |
gtggtggtcgggatttgaaccttgaaccttgcatatattatgcatt |
25395477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 29896284 - 29896329
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
29896284 |
gtggtggtcggggtttgaaccccaaaccttgcatatattatgcatt |
29896329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 244 - 292
Target Start/End: Original strand, 16408697 - 16408745
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
||||||||||||||||||||||| ||| || ||| |||||| ||||||| |
|
|
| T |
16408697 |
gtggtggtcagagtttgaaccctaaactttacatgtattatacattatt |
16408745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 249 - 289
Target Start/End: Complemental strand, 19160007 - 19159967
Alignment:
| Q |
249 |
ggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
19160007 |
ggtcggagtttgaactccgaaccttgcatatattatgcatt |
19159967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 257 - 289
Target Start/End: Original strand, 20120724 - 20120756
Alignment:
| Q |
257 |
tttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
20120724 |
tttgaaccccgaaccttgcatatattatgcatt |
20120756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 247 - 291
Target Start/End: Complemental strand, 29600007 - 29599963
Alignment:
| Q |
247 |
gtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
|||||| |||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
29600007 |
gtggtcggagtttgaaccccggaccttggatatattatgcattat |
29599963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000003; HSPs: 22)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 1091250 - 1091205
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
1091250 |
gtggtggtcagagtttgaaccccgaaccttgcatacattatgcatt |
1091205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 27533314 - 27533269
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||| ||||||||||||||||||||||| |
|
|
| T |
27533314 |
gtggtggtcggggtttgaaccccgaaccttgcatatattatgcatt |
27533269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 260 - 291
Target Start/End: Complemental strand, 35474007 - 35473976
Alignment:
| Q |
260 |
gaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35474007 |
gaaccctgaaccttgcatatattatgcattat |
35473976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 246 - 289
Target Start/End: Complemental strand, 51241559 - 51241516
Alignment:
| Q |
246 |
ggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| |||| | ||||||||||||||||||||||||||||| |
|
|
| T |
51241559 |
ggtggtcggagtctaaaccctgaaccttgcatatattatgcatt |
51241516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 251 - 289
Target Start/End: Original strand, 27449442 - 27449480
Alignment:
| Q |
251 |
tcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
27449442 |
tcagggtttgaaccctgaatcttgcatatattatgcatt |
27449480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 329
Target Start/End: Original strand, 3560422 - 3560455
Alignment:
| Q |
296 |
tatcactaccaactgagttaagctcacgagaata |
329 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
3560422 |
tatccctaccaactgagttaagctcacgagaata |
3560455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 5907858 - 5907825
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
5907858 |
gtttgaaccctggaccttgcatatattatgcatt |
5907825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 16966962 - 16967007
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16966962 |
gtggtggccggagtttgaacctcgaaccttgcatatattatgcatt |
16967007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 16967184 - 16967229
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16967184 |
gtggtggccggagtttgaacctcgaaccttgcatatattatgcatt |
16967229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 17669716 - 17669671
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||||| |||| |
|
|
| T |
17669716 |
gtggtggccggagtttgaaccccgaaccttgcatatattatacatt |
17669671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 285
Target Start/End: Original strand, 18398228 - 18398269
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatg |
285 |
Q |
| |
|
||||||||||||| || || |||||||||||||||||||||| |
|
|
| T |
18398228 |
gtggtggtcagagattaaatcctgaaccttgcatatattatg |
18398269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 26010293 - 26010248
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||| |||||| |||| |
|
|
| T |
26010293 |
gtggtggtcagggtttgaaccccgaaccttgcatgtattatacatt |
26010248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 32962634 - 32962589
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||||| ||||||||||| ||||||||| |
|
|
| T |
32962634 |
gtggtggtcggggtttgaaccctggaccttgcatattttatgcatt |
32962589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 40734995 - 40735040
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||| |||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
40734995 |
gtggtggtcagggtttgaaccccgaaccttacatattttatgcatt |
40735040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 254 - 291
Target Start/End: Original strand, 45418063 - 45418100
Alignment:
| Q |
254 |
gagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
45418063 |
gagttcgaatcctgaaccttgcatatattatgcattat |
45418100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 48681923 - 48681968
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||||| | | ||||||||||||||||||||||| |
|
|
| T |
48681923 |
gtggtggtcggagtttgagctccgaaccttgcatatattatgcatt |
48681968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 256 - 292
Target Start/End: Complemental strand, 13778620 - 13778584
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
13778620 |
gtttgaaccccgaaccttgcatattttatgcattatt |
13778584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 244 - 292
Target Start/End: Complemental strand, 31338090 - 31338042
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
||||||||| ||||||||| || | |||||| ||||||||||||||||| |
|
|
| T |
31338090 |
gtggtggtcggagtttgaatcccgcaccttgtatatattatgcattatt |
31338042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 257 - 289
Target Start/End: Complemental strand, 35011451 - 35011419
Alignment:
| Q |
257 |
tttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
35011451 |
tttgaaccttgaaccttgcatatattatgcatt |
35011419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 247 - 291
Target Start/End: Original strand, 41769808 - 41769852
Alignment:
| Q |
247 |
gtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
|||||| |||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
41769808 |
gtggtcggagtttgaaccccggaccttggatatattatgcattat |
41769852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 257 - 289
Target Start/End: Original strand, 44678020 - 44678052
Alignment:
| Q |
257 |
tttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
44678020 |
tttgaaccccgaaccttgcatatattatgcatt |
44678052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 255 - 287
Target Start/End: Original strand, 48898493 - 48898525
Alignment:
| Q |
255 |
agtttgaaccctgaaccttgcatatattatgca |
287 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
48898493 |
agtttgaaccccgaaccttgcatatattatgca |
48898525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 26)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 245 - 289
Target Start/End: Complemental strand, 27903183 - 27903139
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27903183 |
tggtggtcggagtttgaaccccgaaccttgcatatattatgcatt |
27903139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 245 - 289
Target Start/End: Complemental strand, 39963563 - 39963519
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
39963563 |
tggtggtcagagtttgaaccccgaaccttacatatattatgcatt |
39963519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 244 - 291
Target Start/End: Original strand, 37021362 - 37021409
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||||||| | |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37021362 |
gtggtggtcggggtttgaaccctgaatcttgcatatattatgcattat |
37021409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 20125096 - 20125052
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20125096 |
gtggtggtcggagtttgaaccc-gaaccttgcatatattatgcatt |
20125052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 35493963 - 35494008
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||||||||||| |
|
|
| T |
35493963 |
gtggtggtcggagtttgaatcccgaaccttgcatatattatgcatt |
35494008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 247 - 291
Target Start/End: Complemental strand, 2839866 - 2839822
Alignment:
| Q |
247 |
gtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
|||||| |||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
2839866 |
gtggtcggagtttgaaccccgaaccttggatatattatgcattat |
2839822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 12670065 - 12670109
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
12670065 |
tggtggtcaaggtttgaaccccgaaccttgcatatattatgcatt |
12670109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 258 - 289
Target Start/End: Complemental strand, 16076488 - 16076457
Alignment:
| Q |
258 |
ttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16076488 |
ttgaaccctgaaccttgcatatattatgcatt |
16076457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 257 - 291
Target Start/End: Original strand, 22499126 - 22499160
Alignment:
| Q |
257 |
tttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22499126 |
tttgaaccctgaaccttgcatatattaagcattat |
22499160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 257 - 291
Target Start/End: Complemental strand, 27679556 - 27679522
Alignment:
| Q |
257 |
tttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27679556 |
tttgaaccccgaaccttgcatatattatgcattat |
27679522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 289
Target Start/End: Complemental strand, 13409483 - 13409454
Alignment:
| Q |
260 |
gaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13409483 |
gaaccctgaaccttgcatatattatgcatt |
13409454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 15889482 - 15889437
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
15889482 |
gtggtggtcggggtttgaaccctagaccttgcatatattatgcatt |
15889437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 16579364 - 16579409
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||||||||||||||| |
|
|
| T |
16579364 |
gtggtggtcagggtttgaaccacggaccttgcatatattatgcatt |
16579409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 20688111 - 20688066
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| |||||||||||| | | ||||||||||||||||||||| |
|
|
| T |
20688111 |
gtggtggccagagtttgaactccggaccttgcatatattatgcatt |
20688066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 26913103 - 26913148
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| | ||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
26913103 |
gtggtggccggagtttgaaccttgaacgttgcatatattatgcatt |
26913148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 37054259 - 37054304
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
37054259 |
gtggtggtcggagtttgaaccccgaaccttatatatattatgcatt |
37054304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 40959073 - 40959028
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | || ||||||||||| ||||||||||||||||||| |
|
|
| T |
40959073 |
gtggtggtcggggtctgaaccctgaatcttgcatatattatgcatt |
40959028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 260 - 289
Target Start/End: Complemental strand, 43108624 - 43108595
Alignment:
| Q |
260 |
gaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43108624 |
gaaccctgaaccttgcatatattatgcatt |
43108595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 260 - 292
Target Start/End: Original strand, 1476116 - 1476148
Alignment:
| Q |
260 |
gaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
1476116 |
gaaccctgaaccttgcatatattatgaattatt |
1476148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 328
Target Start/End: Complemental strand, 6414097 - 6414065
Alignment:
| Q |
296 |
tatcactaccaactgagttaagctcacgagaat |
328 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
6414097 |
tatccctaccaactgagttaagctcacgagaat |
6414065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 285
Target Start/End: Complemental strand, 16036897 - 16036857
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatg |
285 |
Q |
| |
|
|||||| ||||||||||||| || ||||||||||||||||| |
|
|
| T |
16036897 |
tggtggccagagtttgaaccatggaccttgcatatattatg |
16036857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 257 - 289
Target Start/End: Complemental strand, 17862037 - 17862005
Alignment:
| Q |
257 |
tttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
17862037 |
tttgaaccctgaactttgcatatattatgcatt |
17862005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 244 - 284
Target Start/End: Complemental strand, 19000020 - 18999980
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattat |
284 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
19000020 |
gtggtggtcagagtttgaaccccaaaccttacatatattat |
18999980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 244 - 284
Target Start/End: Original strand, 25988812 - 25988852
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattat |
284 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
25988812 |
gtggtggtcggagtttgaatcctggaccttgcatatattat |
25988852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 289
Target Start/End: Complemental strand, 33928709 - 33928665
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||| |||||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
33928709 |
tggtggccagagtttaaaccccggaccttgcatatattatgcatt |
33928665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 247 - 291
Target Start/End: Original strand, 34987144 - 34987188
Alignment:
| Q |
247 |
gtggtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
|||||| || ||||||||| |||||||| |||||||||||||||| |
|
|
| T |
34987144 |
gtggtcggaatttgaaccccgaaccttggatatattatgcattat |
34987188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 30)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 244 - 284
Target Start/End: Original strand, 34969383 - 34969423
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattat |
284 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34969383 |
gtggtggtcggagtttgaaccctgaaccttgcatatattat |
34969423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 245 - 289
Target Start/End: Complemental strand, 41521024 - 41520980
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41521024 |
tggtggtcggagtttgaaccttgaaccttgcatatattatgcatt |
41520980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 247 - 289
Target Start/End: Original strand, 13497248 - 13497290
Alignment:
| Q |
247 |
gtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
13497248 |
gtggtcagagtttgaaccctgaaccttgcatattttattcatt |
13497290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 19997354 - 19997399
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
19997354 |
gtggtggtcggagtttgaaccccgaactttgcatatattatgcatt |
19997399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 292
Target Start/End: Original strand, 27550723 - 27550772
Alignment:
| Q |
244 |
gtggtggtcagagtttgaac-cctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
||||||| |||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
27550723 |
gtggtggccagagtttgaacacctggaccttgcatatattatgcattatt |
27550772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 30850386 - 30850419
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30850386 |
gtttgaaccctgaaccttgcatatattatgcatt |
30850419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 244 - 288
Target Start/End: Complemental strand, 18094476 - 18094432
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcat |
288 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||||||||| |
|
|
| T |
18094476 |
gtggtggttagggtttgaaccctggaccttgcatatattatgcat |
18094432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 55421560 - 55421604
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
55421560 |
tggtggtcaggatctgaaccctgaaccttgcatatattatgcatt |
55421604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 256 - 286
Target Start/End: Complemental strand, 23810008 - 23809978
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgc |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23810008 |
gtttgaaccctgaaccttgcatatattatgc |
23809978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 2932194 - 2932149
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| |||| |||||||| ||| ||||||||||||||| |
|
|
| T |
2932194 |
gtggtggtcagaatttgtaccctgaatcttacatatattatgcatt |
2932149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 10148238 - 10148205
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
10148238 |
gtttgaactctgaaccttgcatatattatgcatt |
10148205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 11085755 - 11085800
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
11085755 |
gtggtggtcggagtttgaatctcgaaccttgcatatattatgcatt |
11085800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 11949753 - 11949798
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||| | ||||||||||||||||||||| |
|
|
| T |
11949753 |
gtggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
11949798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 21318243 - 21318288
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
21318243 |
gtggtggtcggggtttgaaccctagaccttgcatatattatgcatt |
21318288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 22040709 - 22040676
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
22040709 |
gtttgaaccccgaaccttgcatatattatgcatt |
22040676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 22411835 - 22411790
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| ||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
22411835 |
gtggtggctagagtttgaaccccgaaccttacatatattatgcatt |
22411790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 25115108 - 25115075
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
25115108 |
gtttgaaccctgaaccttgcatatgttatgcatt |
25115075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 28435250 - 28435283
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
28435250 |
gtttgaaccccgaaccttgcatatattatgcatt |
28435283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 34042299 - 34042266
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
34042299 |
gtttgaaccccgaaccttgcatatattatgcatt |
34042266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 39171372 - 39171405
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
39171372 |
gtttgaaccctgaaccttgcatattttatgcatt |
39171405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 42845096 - 42845051
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
42845096 |
gtggtggtcggagttttaaccccggaccttgcatatattatgcatt |
42845051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 50362141 - 50362174
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
50362141 |
gtttgaaccctggaccttgcatatattatgcatt |
50362174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 54500640 - 54500595
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||| |||||||||| | ||||| ||||||||||||||| |
|
|
| T |
54500640 |
gtggtggtcagtgtttgaaccccggaccttacatatattatgcatt |
54500595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 256 - 288
Target Start/End: Original strand, 4360646 - 4360678
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcat |
288 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
4360646 |
gtttgaaccctgcaccttgcatatattatgcat |
4360678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 244 - 292
Target Start/End: Original strand, 18903748 - 18903796
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
||||||||||| |||||||||| ||||| |||||||||||||||||| |
|
|
| T |
18903748 |
gtggtggtcagggtttgaaccccagaccttacatatattatgcattatt |
18903796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 19479468 - 19479512
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| | |||||||||| | ||||||||||||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
19479512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 289
Target Start/End: Complemental strand, 32268151 - 32268107
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| |||||||||||| |||||| ||||||||||||||| |
|
|
| T |
32268151 |
tggtggtcggagtttgaaccccaaacctttcatatattatgcatt |
32268107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 256 - 292
Target Start/End: Complemental strand, 36521532 - 36521496
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
36521532 |
gtttgaactctgaaccttacatatattatgcattatt |
36521496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 289
Target Start/End: Complemental strand, 44528716 - 44528672
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| ||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
44528716 |
tggtggtcggagttagaacactgaaccttgcgtatattatgcatt |
44528672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 256 - 288
Target Start/End: Original strand, 50152240 - 50152272
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcat |
288 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
50152240 |
gtttgaaccccgaaccttgcatatattatgcat |
50152272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000006; HSPs: 18)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 14279561 - 14279606
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
14279561 |
gtggtggtcagagttcgaaccccgaaccttgcatattttatgcatt |
14279606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 33996140 - 33996095
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
33996140 |
gtggtggtcggagtttgaaccccgaactttgcatatattatgcatt |
33996095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 37141428 - 37141383
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37141428 |
gtggtggccggagtttgaaccccgaaccttgcatatattatgcatt |
37141383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 293
Target Start/End: Original strand, 39138988 - 39139037
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattatta |
293 |
Q |
| |
|
||||||||| |||||||||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
39138988 |
gtggtggtcggagtttgaaccccgaaccttacatattttatgcattatta |
39139037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 244 - 284
Target Start/End: Complemental strand, 12061658 - 12061618
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattat |
284 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
12061658 |
gtggtggtcggactttgaaccctgaaccttgcatatattat |
12061618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 244 - 325
Target Start/End: Original strand, 8999881 - 8999956
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattattagttatcactaccaactgagttaagctcacgag |
325 |
Q |
| |
|
||||||||| | |||||||||||| || ||||||||||||||||| || || |||||||||||| |||||||||||| |
|
|
| T |
8999881 |
gtggtggtcggggtttgaaccctggactttgcatatattatgcat------ttgtctctaccaactgagctaagctcacgag |
8999956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 255 - 289
Target Start/End: Complemental strand, 32285796 - 32285762
Alignment:
| Q |
255 |
agtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32285796 |
agtttgaacccggaaccttgcatatattatgcatt |
32285762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 329
Target Start/End: Complemental strand, 1342752 - 1342719
Alignment:
| Q |
296 |
tatcactaccaactgagttaagctcacgagaata |
329 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
1342752 |
tatctctaccaactgagttaagctcacgagaata |
1342719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 8717477 - 8717510
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
8717477 |
gtttgaaccccgaaccttgcatatattatgcatt |
8717510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 8881334 - 8881301
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
8881334 |
gtttgaaccctggaccttgcatatattatgcatt |
8881301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 29908082 - 29908037
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| ||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
29908082 |
gtggtggtcagattttaaactctggaccttgcatatattatgcatt |
29908037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 30694429 - 30694474
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| |||||||| ||||| ||||||||||||| ||||||||| |
|
|
| T |
30694429 |
gtggtggccagagtttaaaccccgaaccttgcatattttatgcatt |
30694474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 35700385 - 35700430
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||||||||| ||| |||||||||||||||||| |
|
|
| T |
35700385 |
gtggtggtcggagtttgaaccccgaattttgcatatattatgcatt |
35700430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 257 - 289
Target Start/End: Original strand, 12714373 - 12714405
Alignment:
| Q |
257 |
tttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
12714373 |
tttgaaccccgaaccttgcatatattatgcatt |
12714405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 289
Target Start/End: Complemental strand, 23159511 - 23159467
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| | |||||||||| ||| ||||||||||||||||||| |
|
|
| T |
23159511 |
tggtggtcggggtttgaaccccgaatcttgcatatattatgcatt |
23159467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 26196595 - 26196639
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26196595 |
tggtggccggagtttgaaccacgaaccttgcatatattatgcatt |
26196639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 289
Target Start/End: Original strand, 27718885 - 27718929
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| |||||||||| | | ||||||||||||||||||||| |
|
|
| T |
27718885 |
tggtggtcggagtttgaactccggaccttgcatatattatgcatt |
27718929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 328
Target Start/End: Complemental strand, 38344078 - 38344046
Alignment:
| Q |
296 |
tatcactaccaactgagttaagctcacgagaat |
328 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
38344078 |
tatccctaccaactgagttaagctcacgagaat |
38344046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000006; HSPs: 25)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 45727560 - 45727515
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
45727560 |
gtggtggtcggagtttgaaccctaaaccttgcatacattatgcatt |
45727515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 48022304 - 48022349
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||||||||||||||| |
|
|
| T |
48022304 |
gtggtggtcggagtttgaaccccgaactttgcatatattatgcatt |
48022349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 255 - 291
Target Start/End: Original strand, 21567688 - 21567724
Alignment:
| Q |
255 |
agtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
21567688 |
agtttgaaccctgaaccttgcatatattatgtattat |
21567724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 257 - 292
Target Start/End: Original strand, 47099038 - 47099073
Alignment:
| Q |
257 |
tttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47099038 |
tttgaaccccgaaccttgcatatattatgcattatt |
47099073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 247 - 289
Target Start/End: Complemental strand, 37243292 - 37243250
Alignment:
| Q |
247 |
gtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
37243292 |
gtggtcaggatttgaaccctgaaccttgcatatattattcatt |
37243250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 256 - 290
Target Start/End: Complemental strand, 38603017 - 38602983
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatta |
290 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38603017 |
gtttgaaccatgaaccttgcatatattatgcatta |
38602983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 759596 - 759629
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
759596 |
gtttgaaccctgaactttgcatatattatgcatt |
759629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 247 - 292
Target Start/End: Original strand, 4332660 - 4332705
Alignment:
| Q |
247 |
gtggtcagagtttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
|||||| |||||||||||| | |||||| ||||||||||||||||| |
|
|
| T |
4332660 |
gtggtcggagtttgaaccccggaccttggatatattatgcattatt |
4332705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 7202918 - 7202951
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
7202918 |
gtttgaaccctgaaccttgcatattttatgcatt |
7202951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 10594736 - 10594703
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |
|
|
| T |
10594736 |
gtttgaaccctaaaccttgcatatattatgcatt |
10594703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 250 - 291
Target Start/End: Original strand, 16663232 - 16663273
Alignment:
| Q |
250 |
gtcagagtttgaaccctgaaccttgcatatattatgcattat |
291 |
Q |
| |
|
||||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
16663232 |
gtcagggtttgaaccccggaccttgcatatattatgcattat |
16663273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 16792976 - 16793009
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
16792976 |
gtttgaaccctggaccttgcatatattatgcatt |
16793009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 28430555 - 28430600
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28430555 |
gtggtggtcagagtttgaacctcagaccttgcatatattatgcatt |
28430600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Original strand, 30554877 - 30554910
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |
|
|
| T |
30554877 |
gtttgaaccctgaaccttgcatatagtatgcatt |
30554910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 256 - 289
Target Start/End: Complemental strand, 39779083 - 39779050
Alignment:
| Q |
256 |
gtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
39779083 |
gtttgaaccccgaaccttgcatatattatgcatt |
39779050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 45334260 - 45334215
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | ||||||||| ||||||||||||||||||||||| |
|
|
| T |
45334260 |
gtggtggtcgggatttgaaccccgaaccttgcatatattatgcatt |
45334215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 45432019 - 45431974
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| ||| |||||||||| | ||||||||||||||||||||| |
|
|
| T |
45432019 |
gtggtggccagggtttgaaccccggaccttgcatatattatgcatt |
45431974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 48944346 - 48944390
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| |||||||||||||| | ||||||||||||||||||| |
|
|
| T |
48944346 |
gtggtggtcggagtttgaaccctg-atcttgcatatattatgcatt |
48944390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Original strand, 54018396 - 54018441
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
54018396 |
gtggtggccaggatttgaaccctgaaccttgcatattttatgcatt |
54018441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 244 - 288
Target Start/End: Original strand, 8136622 - 8136666
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcat |
288 |
Q |
| |
|
||||||||| | ||||||||| || |||||||||||||||||||| |
|
|
| T |
8136622 |
gtggtggtcggggtttgaaccttggaccttgcatatattatgcat |
8136666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 257 - 289
Target Start/End: Complemental strand, 10926527 - 10926495
Alignment:
| Q |
257 |
tttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
10926527 |
tttgaaccccgaaccttgcatatattatgcatt |
10926495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 257 - 289
Target Start/End: Original strand, 16980357 - 16980389
Alignment:
| Q |
257 |
tttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
16980357 |
tttgaaccatgaaccttgcatatattatgcatt |
16980389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 244 - 292
Target Start/End: Complemental strand, 31214705 - 31214657
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcattatt |
292 |
Q |
| |
|
||||||||| ||||||||| || | ||||| |||||||||||||||||| |
|
|
| T |
31214705 |
gtggtggtcggagtttgaatcccggaccttacatatattatgcattatt |
31214657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 244 - 284
Target Start/End: Complemental strand, 33930410 - 33930370
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattat |
284 |
Q |
| |
|
|||||||||||||||| ||||| | |||||||||||||||| |
|
|
| T |
33930410 |
gtggtggtcagagtttaaaccccggaccttgcatatattat |
33930370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 245 - 289
Target Start/End: Complemental strand, 34899167 - 34899123
Alignment:
| Q |
245 |
tggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||| | |||||||||| | ||||||||||||||||||||| |
|
|
| T |
34899167 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcatt |
34899123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 254 - 289
Target Start/End: Original strand, 72775 - 72810
Alignment:
| Q |
254 |
gagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
72775 |
gagtttgaaccctggaccttgcatatattatgcatt |
72810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 244 - 289
Target Start/End: Complemental strand, 161212 - 161167
Alignment:
| Q |
244 |
gtggtggtcagagtttgaaccctgaaccttgcatatattatgcatt |
289 |
Q |
| |
|
||||||||| | |||||||||| ||||||||||||| ||||||||| |
|
|
| T |
161212 |
gtggtggtcggggtttgaaccccgaaccttgcatattttatgcatt |
161167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University