View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_25 (Length: 406)
Name: NF1240_low_25
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 89 - 377
Target Start/End: Original strand, 47259574 - 47259861
Alignment:
| Q |
89 |
aaagggagcatcctttaaagctattcgaacgaaatacaagcagcacgaggtgaatannnnnnnnnataccattcctaaggctttatcatggcaagtttaa |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47259574 |
aaagggagcatcctttaaagctattcgaacgaaatacaagcagcacgaggtgaatatttttttt-ataccattcctaaggctttatcatggcaagtttaa |
47259672 |
T |
|
| Q |
189 |
tgacatgatatctttttatatgtaacagttcgaatatgtggcagacctgtcttcgcctcctcgtttaccaagttttctgtttggagtgacggagttggat |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47259673 |
tgacatgatatctttttatatgtaacagttcgaatatgtggcagacctgtcttcgcctcctcgtttaccaagttttctgtttggagtgacggagttggat |
47259772 |
T |
|
| Q |
289 |
gtggttccatgattttgcacaagaagcgtgctacatgggctggtatatgacttaactgacaagttatttcaatgctgaatttcaatttt |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47259773 |
gtggttccatgattttgcacaagaagcgtgctacatgggctggtatatgacttaactgacaagttatttcaatgctgaatttcaatttt |
47259861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University