View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_36 (Length: 354)
Name: NF1240_low_36
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_36 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 11 - 327
Target Start/End: Original strand, 34385319 - 34385635
Alignment:
| Q |
11 |
cataggcatctcctaaagcattcaaaaatcaaagttcatatcactaaaatgttaaatatttttctgtctttcttttaacacatgaaacaaagcatgcatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34385319 |
cataggcatctcctaaagcattcaaaaatcaaagttcatatcactaaaatgttaaatatttttctgtctttcttttaacacatgaaacaaagcatgcatt |
34385418 |
T |
|
| Q |
111 |
gaaaaagaaaaatgaactaactaaccactttcaacgcagaattggagctcgtttaacgcggttccttgcaaagttgcgcgaaacgctccatccaacacag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34385419 |
gaaaaagaaaaatgaactaactaaccactttcaacgcagaattggagctcgtttaacgcggttccttgcaaagttgcgcgaaacgctccatccaacacag |
34385518 |
T |
|
| Q |
211 |
gcaagaagagaatataggaagtgttctcttcttctgtctcttcagaatcagaagaaaattctgtctcaagagcagactcttctcttgcttccactagaag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34385519 |
gcaagaagagaatataggaagtgttctcttcttctgtctcttcagaatcagaagaaaattctgtctcaagagcagactcttctcttgcttccactagaag |
34385618 |
T |
|
| Q |
311 |
caattgagtttccattg |
327 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34385619 |
caattgagtttccattg |
34385635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University