View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_49 (Length: 316)
Name: NF1240_low_49
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 96 - 238
Target Start/End: Original strand, 17258437 - 17258579
Alignment:
| Q |
96 |
agatgattcacttattatcaaaacttttcaaggacgtttctatagcatgtatttattaattttgcttcattattgtctgtaggatatcttggaatgtggc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| |||||| || |
|
|
| T |
17258437 |
agatgattcacttattatcaaaacttttcaaggacgtttctgcagcatgtatttattaattttgcttcattattgtatgtaggatatcttagaatgtcgc |
17258536 |
T |
 |
| Q |
196 |
gattcttgctgcaacacagctataattgagactccgatcagta |
238 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
17258537 |
gattcttgctgcaacacaactataattgagacttcgatcagta |
17258579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University