View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_51 (Length: 307)
Name: NF1240_low_51
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 23 - 254
Target Start/End: Original strand, 20823134 - 20823365
Alignment:
| Q |
23 |
cttttttgtaacggatattgatatataatgttagttttacgttggaggtgaggatcaaactcttatcacaccgcgtatttactactccacccttgccact |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20823134 |
cttttttgtaacggatattgatatataatgttagttttacgttggaggtgaggatcaaactcttatcacaccacgtatttactactccacccttgccact |
20823233 |
T |
 |
| Q |
123 |
taaccaaccgattatcaatctatctaaatacaactacatgatgacgacaaactatgaagagaaacgaactaaannnnnnnncagaagtaaaacaaaatct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
20823234 |
taaccaaccgattatcaatctatctaaatacaactacatgatgacggcaaactatgaagataaacgaactaattttttttccagaagtaaaacaaaatct |
20823333 |
T |
 |
| Q |
223 |
tacaccatccgtctatagttataagactattt |
254 |
Q |
| |
|
||| |||||||||| || |||||||| ||||| |
|
|
| T |
20823334 |
tactccatccgtctctaattataagattattt |
20823365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University