View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_56 (Length: 293)
Name: NF1240_low_56
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_56 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 8907597 - 8907376
Alignment:
| Q |
12 |
atgaaaatggacattacaaacactttcatctcttttttctgtaacactgtttctcccaaattgaaacaccttgatgcatgtgaattttctttgcttttcg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8907597 |
atgaaaatggacattacaaacactttcatctcttttttctgtaacactgtttctcccaaattgaaacaccttgatgcatgtgaattttctttgcttttcg |
8907498 |
T |
|
| Q |
112 |
tcacttcattgcgctagctagctagctattacttctctccttcttgtagataaataggtcgcagctaattagagctcttctcccttccttaattaagagt |
211 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8907497 |
tcacttcat-----------------tattacttctctc---cttgtagataaataggtcgcagctaattagagctcttctcccttccttaattaagagt |
8907418 |
T |
|
| Q |
212 |
gtattctctaaaaatcgaacctcagtccaacccgacaaactc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8907417 |
gtattctctaaaaatcgaacctcagtccaacccgacaaactc |
8907376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University