View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_58 (Length: 291)
Name: NF1240_low_58
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 85 - 195
Target Start/End: Original strand, 4233150 - 4233260
Alignment:
| Q |
85 |
atgaatcggcgaaatcgatatgtgaattagaaacgaaaaaggagatattgaattacctttgaaggatgcgctaaaaccctagcagcaaggaagagaatga |
184 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4233150 |
atgaatcggcgaaatggatatgtgaattagaaacgaaaaaggagatattgaattacctttgaaggatgcgctaaaaccctagcagcaaggaagagaatga |
4233249 |
T |
|
| Q |
185 |
gagtggagtaa |
195 |
Q |
| |
|
||||||||||| |
|
|
| T |
4233250 |
gagtggagtaa |
4233260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 141 - 180
Target Start/End: Original strand, 29833800 - 29833839
Alignment:
| Q |
141 |
ctttgaaggatgcgctaaaaccctagcagcaaggaagaga |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29833800 |
ctttgaaggatgcgctaaaaccctagcagcaaggaagaga |
29833839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University