View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_62 (Length: 281)
Name: NF1240_low_62
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_62 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 60 - 241
Target Start/End: Complemental strand, 14965243 - 14965062
Alignment:
| Q |
60 |
tgtttgtcaccaaaaggtaggctttttggagtttgtcaaacctaaccaaacatatacaaatcaacaaagaaaatgaccccatatgcgataataattaata |
159 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14965243 |
tgtttgttaccaaaaggtaggctttttggagtttatcaaacctaaccaaacatatacaaatcaacaaagaaaatgaccccatatgcgataataattaata |
14965144 |
T |
|
| Q |
160 |
gtgattaatcttatagtattaatagtagttgtaatacaaagatgacatataatcataaatttaagagttagaactagtataa |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14965143 |
gtgattaatcttatagtattaatagtagttgtaatagaaagatgacatataatcataaatttaagagttggaactagtataa |
14965062 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University