View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_67 (Length: 271)
Name: NF1240_low_67
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_67 |
 | |
|
| [»] scaffold0202 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 64; Significance: 5e-28; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 54 - 166
Target Start/End: Original strand, 31045551 - 31045665
Alignment:
| Q |
54 |
gaaacttgaatgaatcatcttactagagagaacatgtgagacacttatgcctgtatataacaactatttgaatcagaa--ttctgatttatatatgaata |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||| ||| ||| |||||| ||||||||||| || || |||||||||||||||||||| |
|
|
| T |
31045551 |
gaaacttgaatgaatcatcttactagagagatcatgtgcgacacctatccctatatatagtaactatttgaaccaaaattttctgatttatatatgaata |
31045650 |
T |
|
| Q |
152 |
ttttgacaattcata |
166 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
31045651 |
tttcgacaattcata |
31045665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 54 - 113
Target Start/End: Original strand, 31056620 - 31056679
Alignment:
| Q |
54 |
gaaacttgaatgaatcatcttactagagagaacatgtgagacacttatgcctgtatataa |
113 |
Q |
| |
|
||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
31056620 |
gaaacttaaatgaataatcttatcagagagaacatgtgagacacttatgcctgtatataa |
31056679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 58 - 101
Target Start/End: Complemental strand, 31096523 - 31096480
Alignment:
| Q |
58 |
cttgaatgaatcatcttactagagagaacatgtgagacacttat |
101 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
31096523 |
cttgaatgaatcatctttgtagagagaacatgtgagatacttat |
31096480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 55 - 84
Target Start/End: Original strand, 31035350 - 31035379
Alignment:
| Q |
55 |
aaacttgaatgaatcatcttactagagaga |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31035350 |
aaacttgaatgaatcatcttactagagaga |
31035379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0202 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0202
Description:
Target: scaffold0202; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 54 - 113
Target Start/End: Complemental strand, 5239 - 5180
Alignment:
| Q |
54 |
gaaacttgaatgaatcatcttactagagagaacatgtgagacacttatgcctgtatataa |
113 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
5239 |
gaaacttgaatgaatcatctttgtagagagaacacatgagacacttatgcctatatataa |
5180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University