View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1240_low_79 (Length: 248)

Name: NF1240_low_79
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1240_low_79
NF1240_low_79
[»] chr1 (1 HSPs)
chr1 (13-242)||(43864089-43864318)


Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 242
Target Start/End: Original strand, 43864089 - 43864318
Alignment:
13 aaggcggtgggtggtgaatatttgtgtggtgcagatacgtctacggttgcgccaccgtgagtcggcatgggaccatgcgagtgtgtcgttgacgttgggt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
43864089 aaggcggtgggtggtgaatatttgtgtggtgcagatacgtctacggttacgccaccgtgagtcggcatgggaccatgcgagtgtgtcgttgacgttgggt 43864188  T
113 tgagcagcaactgattcagggatagggcggttggcgaaggattggtcgnnnnnnnggaggatttcttgggcggttgtcggggaggaagcaacggtgacgg 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||| ||||||||||||||||||||||||    
43864189 tgagcagcaactgattcagggatagggcggttggcgaaggattggtcgtttttttggaggatttcttgggcggttttcggggaggaagcaacggtgacgg 43864288  T
213 tgacggagccgaagcggagggacatgatgg 242  Q
    ||||||||||||||||||||||||||||||    
43864289 tgacggagccgaagcggagggacatgatgg 43864318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University