View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_79 (Length: 248)
Name: NF1240_low_79
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_79 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 242
Target Start/End: Original strand, 43864089 - 43864318
Alignment:
| Q |
13 |
aaggcggtgggtggtgaatatttgtgtggtgcagatacgtctacggttgcgccaccgtgagtcggcatgggaccatgcgagtgtgtcgttgacgttgggt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43864089 |
aaggcggtgggtggtgaatatttgtgtggtgcagatacgtctacggttacgccaccgtgagtcggcatgggaccatgcgagtgtgtcgttgacgttgggt |
43864188 |
T |
|
| Q |
113 |
tgagcagcaactgattcagggatagggcggttggcgaaggattggtcgnnnnnnnggaggatttcttgggcggttgtcggggaggaagcaacggtgacgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43864189 |
tgagcagcaactgattcagggatagggcggttggcgaaggattggtcgtttttttggaggatttcttgggcggttttcggggaggaagcaacggtgacgg |
43864288 |
T |
|
| Q |
213 |
tgacggagccgaagcggagggacatgatgg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43864289 |
tgacggagccgaagcggagggacatgatgg |
43864318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University