View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_88 (Length: 207)
Name: NF1240_low_88
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_88 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 10434703 - 10434658
Alignment:
| Q |
1 |
agacaaccataatgttgatactatcatactttttaatggagaaagt |
46 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10434703 |
agacaagcataatgttgatactatcatactttttaatggataaagt |
10434658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University