View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1240_low_91 (Length: 203)

Name: NF1240_low_91
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1240_low_91
NF1240_low_91
[»] chr3 (1 HSPs)
chr3 (1-173)||(40965817-40965992)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 40965992 - 40965817
Alignment:
1 attgattttattttctttcataa---atagcctaaatgcgaaactaatacacactaaatagtaagaaataaagaattgcgggtaacatatgtatgcaaaa 97  Q
    |||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40965992 attgattttattttctttcataataaatagcctaaatgcgaaactaatacacactaaatagtaagaaataaagaattgcgggtaacatatgtatgcaaaa 40965893  T
98 atgagttttccatcaaaacttacatagggcacactatcctcctcttcttcgtcatagaactcgacgctatcctcat 173  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40965892 ttgagttttccatcaaaacttacatagggcacactatcctcctcttcttcgtcatagaactcgacgctatcctcat 40965817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University