View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1240_low_92 (Length: 203)
Name: NF1240_low_92
Description: NF1240
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1240_low_92 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 5e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 5e-64
Query Start/End: Original strand, 25 - 156
Target Start/End: Complemental strand, 23987247 - 23987116
Alignment:
| Q |
25 |
attatacttgagtttatctgtagtaggattgaaaatcccgaagtcttgcgccaatacatgaaaattcataccatgaagatgcatgggatgactttgcgca |
124 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23987247 |
attatacttgagtttatcagtagtaggattgaaaatcccgaagtcttgcgccaaaacatgaaaattcataccatgaagatgcatgggatgactttgcgca |
23987148 |
T |
|
| Q |
125 |
ttcaaaatcgctgtattttgaaacacaatctc |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23987147 |
ttcaaaatcgctgtattttgaaacacaatctc |
23987116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 26 - 101
Target Start/End: Complemental strand, 19743710 - 19743635
Alignment:
| Q |
26 |
ttatacttgagtttatctgtagtaggattgaaaatcccgaagtcttgcgccaatacatgaaaattcataccatgaa |
101 |
Q |
| |
|
|||||||||||||||||| ||| |||| |||||||| | | |||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
19743710 |
ttatacttgagtttatctctagcaggaatgaaaatctccaggtcttgagccaaaacatgtaaattcataccatgaa |
19743635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University