View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241-Insertion-11 (Length: 133)
Name: NF1241-Insertion-11
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241-Insertion-11 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 7 - 133
Target Start/End: Complemental strand, 2394225 - 2394099
Alignment:
| Q |
7 |
aacaatccaataaaccactaagatagactctgagattataaacggagataattttagtctttaaaatttgtaaatagaggaacatactctaaattaaaag |
106 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
2394225 |
aacaatctaataaaccactaagatagactctgagattataaacagagataattttagtctttaaaatttgtaaatagacgaacatactcgaaattaaaag |
2394126 |
T |
 |
| Q |
107 |
acgtcattcactcattctagcaactca |
133 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
2394125 |
acgtcattcactcattctagcaactca |
2394099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University