View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241-Insertion-6 (Length: 400)
Name: NF1241-Insertion-6
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241-Insertion-6 |
 |  |
|
| [»] chr8 (6 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 187; Significance: 1e-101; HSPs: 6)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 206 - 400
Target Start/End: Complemental strand, 17576156 - 17575962
Alignment:
| Q |
206 |
ttgcttataattaggatctcagagagaaattaaaaacctgcttttcatctaacaggacacgttttccgagatccgctgcattccggaaccttctacgggg |
305 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17576156 |
ttgcctataatgaggatctcagagagaaattaaaaacctgcttttcatctaacaggacacgttttccgagatccgctgcattccggaaccttctacgggg |
17576057 |
T |
 |
| Q |
306 |
attcttcaccagcgagacggcgcttctccaacggctcaacgcatctatactccgatccttatcctctaattcgaagtctttcagaaatccctcca |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17576056 |
attcttcaccagcgagacggcgcttctccaacggctcaacgcatctatactccgatccttatcctctaattcgaagtctttcagaaatccctcca |
17575962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 173; E-Value: 6e-93
Query Start/End: Original strand, 206 - 400
Target Start/End: Original strand, 17072117 - 17072309
Alignment:
| Q |
206 |
ttgcttataattaggatctcagagagaaattaaaaacctgcttttcatctaacaggacacgttttccgagatccgctgcattccggaaccttctacgggg |
305 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
17072117 |
ttgcctataatgaggatctcagagagaaattaaaa--ctgcttttcatctaacaggacacgttttccgagatccgctgcattccggaacnttctacgggg |
17072214 |
T |
 |
| Q |
306 |
attcttcaccagcgagacggcgcttctccaacggctcaacgcatctatactccgatccttatcctctaattcgaagtctttcagaaatccctcca |
400 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17072215 |
attcttcaccagcgagacggcgcttctccaacggctcaacgcatctatactccgatccttatcctctaattcgaagtctttcagaaatccctcca |
17072309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 91 - 156
Target Start/End: Original strand, 17071960 - 17072026
Alignment:
| Q |
91 |
gacacaaaaaactttggtttaaatttgagggaaatacattttaactt-ttgcttatattattattaa |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
17071960 |
gacacaaaaaactttggtttaaatttgagggaaatacattttaacttgttgcttatattataattaa |
17072026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 91 - 156
Target Start/End: Complemental strand, 17576313 - 17576247
Alignment:
| Q |
91 |
gacacaaaaaactttggtttaaatttgagggaaatacattttaactt-ttgcttatattattattaa |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
17576313 |
gacacaaaaaactttggtttaaatttgagggaaatacattttaacttgttgcttatattataattaa |
17576247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 8 - 59
Target Start/End: Original strand, 17070501 - 17070552
Alignment:
| Q |
8 |
ataggtccagagggtcaccccagaggattatgtaccccagaggatgtgatac |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17070501 |
ataggtccagagggtcaccccagaggattatgtaccccagaggatgtgatac |
17070552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 8 - 59
Target Start/End: Complemental strand, 17577772 - 17577721
Alignment:
| Q |
8 |
ataggtccagagggtcaccccagaggattatgtaccccagaggatgtgatac |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17577772 |
ataggtccagagggtcaccccagaggattatgtaccccagaggatgtgatac |
17577721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University