View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12411_low_11 (Length: 250)
Name: NF12411_low_11
Description: NF12411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12411_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 20 - 231
Target Start/End: Original strand, 45380402 - 45380613
Alignment:
| Q |
20 |
agactatgtcaaggaatggattgggagtcagatttgtccatcaaatgctgattgggatgatgatattggcagtgctaagatcaataacattcaggagaaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45380402 |
agactatgtcaaggaatggattgggagtcaaatttgtccatcaaatgctgattgggatgatggtattggcagtgctaagatcaacaacattcaggagaag |
45380501 |
T |
|
| Q |
120 |
tctgagttggaaaattcaagtccaactgataaagccagtgatgcaaatggaccacaattactacaagtatctgtgatggaaaatgcagataataaagttg |
219 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45380502 |
tcagagttggaaaattcaagtccaattgataaagccagtgatgcaaatggaacacaattactacaagtatctgtgatggaaaatgcagataataaagttg |
45380601 |
T |
|
| Q |
220 |
ttgatatgaaag |
231 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45380602 |
ttgatatgaaag |
45380613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University