View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12411_low_6 (Length: 271)
Name: NF12411_low_6
Description: NF12411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12411_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 83 - 239
Target Start/End: Original strand, 41549551 - 41549707
Alignment:
| Q |
83 |
aaacacctcgcgaatggatcacgaaaagaaaatgggtattgaaaatctcccactaaccatgcatgaggcggttacaatggatgcactcgtgggaagtctg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| |||||||||| ||||| |||||||||||||||| ||||||| |
|
|
| T |
41549551 |
aaacacctcgcgaatggatcacgaaaagaaaacgggtattgaaaatcttccactaactatgcatgaggtggttataatggatgcactcgtgaaaagtctg |
41549650 |
T |
 |
| Q |
183 |
tgaattaattttcgctataaaaagcattttcttaaattaaattcaaactatattttt |
239 |
Q |
| |
|
| |||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41549651 |
taaattaatttttgctataaaaagcattttcttaaattaaattcaaattatattttt |
41549707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 10 - 85
Target Start/End: Original strand, 41549452 - 41549527
Alignment:
| Q |
10 |
aacctgtgttccaaagtaaaatatcctcatagccaatacattagatttaattatcaagtgaaatcataaaatcaaa |
85 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41549452 |
aaccggtgttccaaactaaaatatcctcatagccaatgcactagatttaattatcaagtgaaatcataaaatcaaa |
41549527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University