View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12413_high_11 (Length: 241)
Name: NF12413_high_11
Description: NF12413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12413_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 17 - 233
Target Start/End: Original strand, 52873394 - 52873603
Alignment:
| Q |
17 |
aaacaaaatgttaaaataattttaaggactaagaacatatttaaacnnnnnnnnnnctttctttcgcactgcagttatctggatcagttgctgtttgtgt |
116 |
Q |
| |
|
||||||||| |||||||| ||||| ||||||||||||||||||| | ||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
52873394 |
aaacaaaatattaaaatagttttagggactaagaacatatttaacccctt-------ttttttttgcactgcagttatctggatcagttgctgtttgtgt |
52873486 |
T |
 |
| Q |
117 |
tcgtggtaactgcgactacacaactaaagctacattatcacagtcagtgggtgctactgctgtgttgatgataaatgagagtaacttccccacccataca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52873487 |
tcgtggtaactgcgactacacaactaaagctacattatcacagtcagtgggtgctactgctgtgttgatgataaatgagagtaacttccccacccataca |
52873586 |
T |
 |
| Q |
217 |
tcccattcatctcactc |
233 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
52873587 |
tcccattcatttcactc |
52873603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University