View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12413_high_8 (Length: 302)
Name: NF12413_high_8
Description: NF12413
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12413_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 19 - 300
Target Start/End: Complemental strand, 46094821 - 46094536
Alignment:
| Q |
19 |
catctgaaatggatttaggtgtagagaggtatggggttggtgccctcaccatattttgttcatgagaggaatattatgaaatatatcttacgataacaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
46094821 |
catctgaaatggatttaggtgtagagaggtatggggttggtgccctcaccatattttgttcatgagaggaatattatgaaatatattttacaataacaat |
46094722 |
T |
 |
| Q |
119 |
aagagaggtatgattaacgattctctcctagggttagcgccgctgactttccgtagtgagtgtattgatgtcgttcggtaagttttgctttcctgaacgt |
218 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46094721 |
aagagaggtatgattaacaattctctcctagggttagcgccgctgactttccgtagtgagtgtattgatgtcgttcggtaagttttgctttcctgaacgt |
46094622 |
T |
 |
| Q |
219 |
----ttgtgtttttgctttccataaagccttgatgcctttgttttcttttcatgcctgtgtcatgcgattatgcttcctgcctttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46094621 |
ttgtttgtgtttttgctttccataaagccttgatgcctttgttttcttttcatgcctgtgtcatgcgattatgcttcctgcctttg |
46094536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University