View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12414_low_3 (Length: 279)
Name: NF12414_low_3
Description: NF12414
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12414_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 5e-62; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 123 - 263
Target Start/End: Complemental strand, 27436445 - 27436305
Alignment:
| Q |
123 |
cctgattcctaaccggggtgaccgctcctttttctctccaatcgaaatcatgaggaaggttctctgtcgaaagaataggtgcagcttttgcatgtctcgg |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27436445 |
cctgattcctaaccggggtaaccgctcctttttctctccaatcaaaatcacgaggaaggttctcggtcgaaagaataggtgcagcttttgcatgtctcgg |
27436346 |
T |
 |
| Q |
223 |
taaccctactccttttaatcccaagatgctattatgaaact |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27436345 |
taaccctactccttttaatcccaagatgctattacgaaact |
27436305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 123 - 263
Target Start/End: Complemental strand, 27944937 - 27944797
Alignment:
| Q |
123 |
cctgattcctaaccggggtgaccgctcctttttctctccaatcgaaatcatgaggaaggttctctgtcgaaagaataggtgcagcttttgcatgtctcgg |
222 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
27944937 |
cctgattcctaaccggggtaaccgctcctttttctctccaatcaaaatcacgaggaaggttctcggacgaaagaataggtgcagcttttgcatgtctcgg |
27944838 |
T |
 |
| Q |
223 |
taaccctactccttttaatcccaagatgctattatgaaact |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27944837 |
taaccctactccttttaatcccaagatgctattacgaaact |
27944797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 123 - 263
Target Start/End: Original strand, 27549791 - 27549931
Alignment:
| Q |
123 |
cctgattcctaaccggggtgaccgctcctttttctctccaatcgaaatcatgaggaaggttctctgtcgaaagaataggtgcagcttttgcatgtctcgg |
222 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| |||||| ||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
27549791 |
cctgattcctaacaggggtaaccgctcctttttctctccaatcaaaatcacgaggaaggttctcggacgaaagaataggtgcagcttttgcatgtctcgg |
27549890 |
T |
 |
| Q |
223 |
taaccctactccttttaatcccaagatgctattatgaaact |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27549891 |
taaccctactccttttaatcccaagatgctattacgaaact |
27549931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University