View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12415_high_2 (Length: 452)
Name: NF12415_high_2
Description: NF12415
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12415_high_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 17 - 278
Target Start/End: Complemental strand, 14271622 - 14271361
Alignment:
| Q |
17 |
agtggcaatggtgttgcatccggtgtttagttggttgttgatggttaaatttgggtggggattggtgggtgctgcggtgagtcttaatggctcatggtgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14271622 |
agtggcaatggtgttgcatccggtgtttagttggttgctgatggttaaatttgggtggggattggtgggtgctgcggtgagtcttaatggctcatggtgg |
14271523 |
T |
|
| Q |
117 |
ttcattgtggtggctcaattggggtatgtgtttagtgggaaatgtggtatagcttggaatggattttcttttgaagcgtttaggaatctttggggattct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14271522 |
ttcattgtggtggctcaattggggtatgtgtttagtgggaaatgtggtatagcttggaatggattttcttttgaagcgtttaggaacctttggggattct |
14271423 |
T |
|
| Q |
217 |
ttcgtctttctttggcttctgctgtgatgctatggttagttacctccaaaacttgaaactcc |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14271422 |
ttcgtctttctttggcttctgctgtgatgctatggttagttaactccaaaacttgaaactcc |
14271361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 314 - 443
Target Start/End: Complemental strand, 14271323 - 14271194
Alignment:
| Q |
314 |
gagtttaattaaaatgtcggtatagaattataagttttatttgtatctaatnnnnnnnntgttatgcttgaacnnnnnnnnttgttatggcaattaatat |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | |||||||| |||||||||| |
|
|
| T |
14271323 |
gagtttaattaaaatgtcggtatagaattataagttttatttgtatctaataaaaaaaatgttatgcttgaccaaaaaaaattgttatgacaattaatat |
14271224 |
T |
|
| Q |
414 |
gatggagattggagacatcgacacaggttc |
443 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
14271223 |
gatggagattggagacatcgattcaggttc |
14271194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University