View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12419_high_24 (Length: 367)

Name: NF12419_high_24
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12419_high_24
NF12419_high_24
[»] chr6 (2 HSPs)
chr6 (240-352)||(26841728-26841840)
chr6 (55-157)||(26841393-26841494)


Alignment Details
Target: chr6 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 240 - 352
Target Start/End: Original strand, 26841728 - 26841840
Alignment:
240 aagatgtcaatgttgttctaatgttggtttttctgaatgtttgtgtagtattaggtgcactaaatatgttgttttgtggttttgacagatttgcctgttt 339  Q
    |||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
26841728 aagatgacaatgttgttctaatgttggtttttctgaatgtttgggtagtattaggtgcactaaatatgttgttttggggttttgacagatttgcctgttt 26841827  T
340 gttttaatcccct 352  Q
    |||||||||||||    
26841828 gttttaatcccct 26841840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 55 - 157
Target Start/End: Original strand, 26841393 - 26841494
Alignment:
55 aactttggtaattgaatgaagtgttctttatttgtttaatttcatggcagggattagggaannnnnnnnaataggatgattggcttgatcattaggatgg 154  Q
    ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||        |||||||||||||||||||||||||||||||    
26841393 aacttcggtaattgaatgaagtgttctttatttgtttaatctcatggcagggattagggaa-tttttttaataggatgattggcttgatcattaggatgg 26841491  T
155 atc 157  Q
    |||    
26841492 atc 26841494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University