View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_high_28 (Length: 318)
Name: NF12419_high_28
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 20 - 313
Target Start/End: Complemental strand, 48861583 - 48861293
Alignment:
| Q |
20 |
acatgaggaccctgctgcaaaagggtgggtgagggtactaatagcaaccttggaggaagctccaaacacttgtcactactgggattagtgaagggcacaa |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48861583 |
acatgaggaccctgctgcaaaagggtgggtgagggtactaatagcaaccttggaggaagctccaaacacttgtcactactgggattagtgaagggcacaa |
48861484 |
T |
 |
| Q |
120 |
gtgcattgcaaagccttggctttcctggttcttgttcccaaagaaatggtactgaacctgaggtttgcagtggtggagtcaccgtccccgttctctctgg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48861483 |
gtgcattgcaaagccttggctttcctggttcttgttcccaaagaaatggtactgaacctgaggtttgaagtggtggagtcaccgtccccgttctctctgg |
48861384 |
T |
 |
| Q |
220 |
ggattccatttgcatttgaattttcattgctgctggtgagacagagaacaaagggagcgttggtatgctgctgctctcttgctctgcctatgct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
48861383 |
ggattccatttgcatttgaattttcattgctgctggtgagacagagaacaaagggagccttggtatgc---tgctctcttgctctgcctttgct |
48861293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University