View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_high_35 (Length: 290)
Name: NF12419_high_35
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_high_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 16 - 275
Target Start/End: Original strand, 30781265 - 30781524
Alignment:
| Q |
16 |
aaaatatattcttaattacgaatacaggcaaatatcacgttgttatgtagatctgaaatgtgcatatgacagaatatattccatataagaaaatatatac |
115 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
30781265 |
aaaatatattattaattacgaatacaggcaaatatcacgttgttatgtagatctgaaatgtgcatatgacagaatatattccatataagaagatacatac |
30781364 |
T |
 |
| Q |
116 |
tatggtatctagttgggtggtattttggcctattgataagtgaaatgattttaggaatggttacgtttatatgattataatttagattggtggatctgaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30781365 |
tatggtatctagttgggtggtattttggcctattgataagtgaaatgattttaggaatggttacgtttatatgattataatttagattggtggatctgaa |
30781464 |
T |
 |
| Q |
216 |
ccttattgttaagggtgggaaaaatagcctctaaaaaatgtagaacctgtatataagcac |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30781465 |
ccttattgttaagggtgggaaaaatagcctctaaaaaatgtagaacctgtatataagcac |
30781524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University