View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_high_45 (Length: 242)
Name: NF12419_high_45
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_high_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 102 - 224
Target Start/End: Complemental strand, 1274521 - 1274399
Alignment:
| Q |
102 |
ttaggccaacccctccacctaaaaatttgtacatataattaatgtgnnnnnnnccaaacataaacctatgatccctactaaaacataaaccttatataaa |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1274521 |
ttaggccaacccctccacctaaaaatttgtacatataattaatgtgaaaaaaaccaaacataaacctatgatccctactaaaacataaaccttatataaa |
1274422 |
T |
 |
| Q |
202 |
ttccaactaaaaaacaaaacaca |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
1274421 |
ttccaactaaaaaacaaaacaca |
1274399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 1274622 - 1274587
Alignment:
| Q |
1 |
attctaaatgatcctctaattttcattggaatcatc |
36 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1274622 |
attctaaatgatcttctaattttcattggaatcatc |
1274587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University