View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_high_48 (Length: 229)
Name: NF12419_high_48
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_high_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 218
Target Start/End: Original strand, 523987 - 524188
Alignment:
| Q |
17 |
gacatcagggttagtttcaatgtttcatctctttctaaagaattctttgttctacttaattgacttattttccagattctacaatacttttcaatttcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
523987 |
gacatcagggttagtttcaatgtttcatctctttctaaggaattctttgttctccttaattgacttattttccagattctacaaaacttttcaatttcat |
524086 |
T |
 |
| Q |
117 |
actcttacatgctctcatttcttaatttgcattgcagtgttcttgttcagttttggtgtagttatatgacagtgcccctgaatgtaatagtttcacaggt |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
524087 |
actcttagatgctctcatttcttaatttgcattgcagcgttcttgttcagttttggtgtagctatatgacagtgcccctgaatgtaatagtttcacaggt |
524186 |
T |
 |
| Q |
217 |
tc |
218 |
Q |
| |
|
|| |
|
|
| T |
524187 |
tc |
524188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University