View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_high_51 (Length: 222)
Name: NF12419_high_51
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_high_51 |
 | |
|
| [»] scaffold0119 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0119 (Bit Score: 96; Significance: 3e-47; HSPs: 3)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 85 - 215
Target Start/End: Complemental strand, 31666 - 31540
Alignment:
| Q |
85 |
cgatggtatcagctgtgtgttgaattgaagttaatttt-agcaggggttgcgttttacatccccttccttcttttgagttgagttgagagaaccaacatt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31666 |
cgatggtatcagctgtgtgttgaattgaagttaattttgagcaggggttgcgttttacatccccttccttcttttgagttgag-----agaaccaacatt |
31572 |
T |
|
| Q |
184 |
gtatgaaattagtgggaaaaccacaggttctg |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
31571 |
gtatgaaattagtgggaaaaccgtaggttctg |
31540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 33354 - 33283
Alignment:
| Q |
18 |
cattaaggtcaaacaaagaaattcaatgtagcgaaggtaatgttttaggaatcatctggctagatagcgatg |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33354 |
cattaaggtcaaacaaagaaattcaatgtagcgaaggtaatgttttaggaatcatctggctagatagtgatg |
33283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 22255 - 22184
Alignment:
| Q |
18 |
cattaaggtcaaacaaagaaattcaatgtagcgaaggtaatgttttaggaatcatctggctagatagcgatg |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
22255 |
cattaaggtcaaacaaagaaattcaatgtagcgaaggtaatgttttaggaatcatctggctatatagtgatg |
22184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 85 - 215
Target Start/End: Original strand, 1281015 - 1281141
Alignment:
| Q |
85 |
cgatggtatcagctgtgtgttgaattgaagttaatttt-agcaggggttgcgttttacatccccttccttcttttgagttgagttgagagaaccaacatt |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1281015 |
cgatggtatcagctgtgtgttgaattgaagttaattttgagcaggggttgcgttttacatccccttccttcttttga-----gttgagagaaccaacatt |
1281109 |
T |
|
| Q |
184 |
gtatgaaattagtgggaaaaccacaggttctg |
215 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |
|
|
| T |
1281110 |
gtatgaaattagtgggaaaaccgtaggttctg |
1281141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 1278836 - 1278907
Alignment:
| Q |
18 |
cattaaggtcaaacaaagaaattcaatgtagcgaaggtaatgttttaggaatcatctggctagatagcgatg |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
1278836 |
cattaaggtcaaacaaagaaattcaatgtagcgaaggtaatgttttaggaatcatctggctatatagtgatg |
1278907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University