View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_high_55 (Length: 213)
Name: NF12419_high_55
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_high_55 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 13 - 110
Target Start/End: Complemental strand, 7150399 - 7150302
Alignment:
| Q |
13 |
ctgtggctacatcgtgatnnnnnnngatttggattttggcggtggatgtgaccgttgaaaggagacaaatagttgttaggttgggggaatttgagtta |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7150399 |
ctgtggctacatcgtgataaaaaaagatttggattttggcggtggatgtgacagttgaaaggagacaaatagttgttaggttgggggaatttgagtta |
7150302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 137
Target Start/End: Complemental strand, 7149531 - 7149496
Alignment:
| Q |
102 |
tttgagttataaattatctaaatttctcttatcaac |
137 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7149531 |
tttgagttataagttatctaaatttctcttatcaac |
7149496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University