View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_low_24 (Length: 367)
Name: NF12419_low_24
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 101; Significance: 5e-50; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 240 - 352
Target Start/End: Original strand, 26841728 - 26841840
Alignment:
| Q |
240 |
aagatgtcaatgttgttctaatgttggtttttctgaatgtttgtgtagtattaggtgcactaaatatgttgttttgtggttttgacagatttgcctgttt |
339 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
26841728 |
aagatgacaatgttgttctaatgttggtttttctgaatgtttgggtagtattaggtgcactaaatatgttgttttggggttttgacagatttgcctgttt |
26841827 |
T |
 |
| Q |
340 |
gttttaatcccct |
352 |
Q |
| |
|
||||||||||||| |
|
|
| T |
26841828 |
gttttaatcccct |
26841840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 55 - 157
Target Start/End: Original strand, 26841393 - 26841494
Alignment:
| Q |
55 |
aactttggtaattgaatgaagtgttctttatttgtttaatttcatggcagggattagggaannnnnnnnaataggatgattggcttgatcattaggatgg |
154 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26841393 |
aacttcggtaattgaatgaagtgttctttatttgtttaatctcatggcagggattagggaa-tttttttaataggatgattggcttgatcattaggatgg |
26841491 |
T |
 |
| Q |
155 |
atc |
157 |
Q |
| |
|
||| |
|
|
| T |
26841492 |
atc |
26841494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University