View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_low_35 (Length: 291)
Name: NF12419_low_35
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 273
Target Start/End: Original strand, 43293333 - 43293590
Alignment:
| Q |
16 |
gctcttgaacccaactcgtttcttaannnnnnn-ataaaataaataattagaggaagataaccaatttccctgcattaagagaaataaaaggctttgcaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |||||||| ||||||||||||||||| |
|
|
| T |
43293333 |
gctcttgaacccaactcgtttcttaattttttttataaaataaataattagaggaagataaccaattgcccttcattaaga--aataaaaggctttgcaa |
43293430 |
T |
 |
| Q |
115 |
gagttctcatttatcaagannnnnnnnnnnnnnnngtgtgttgataatagtcattccttatgcttgaggcaaaatagtttgaaactaaccccattaactc |
214 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
43293431 |
gagttctcatttatcaagatttttttttgttttt-gtgtgttgataatagttattccttatgcttgaggcaaaatagtttgaaactaa-cccattaactc |
43293528 |
T |
 |
| Q |
215 |
tagaattttcattcaggtca---gatgattatcacttgtgaaattgttgccaacttggcttg |
273 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43293529 |
tagaattttcattcaggtcagatgatgattatcacttgtgaaattgttgccaacttggcttg |
43293590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University