View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_low_43 (Length: 249)
Name: NF12419_low_43
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 29179333 - 29179098
Alignment:
| Q |
1 |
gaggaccctcaatacgaaactcatgcataacccattcagtttttctccctttaggtgcccttccttgatagaacactaaagtctttctcattccaacaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29179333 |
gaggaccctcaatacgaaactcatgcataacccattcagtttttctccctttaggtgcccttccttgatagaacactaaagtctttctcattccaacaag |
29179234 |
T |
 |
| Q |
101 |
agtgcccttacgaaggatagctctgtcctttcctgttgctttccaataacctgatgcagttgcacgatttgttcgtagtcctgttgcatatttacggtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29179233 |
agtgcccttacgaaggatagctctgtcctttcctgttgctttccaataacctgatgcagttgcacgatttgttcgtagtcctgttgcatatttacgatct |
29179134 |
T |
 |
| Q |
201 |
ctttgtgtgtagaaataccactctttccctcccaca |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29179133 |
ctttgtgtgtagaaataccactctttccctcccaca |
29179098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University