View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_low_45 (Length: 248)
Name: NF12419_low_45
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_low_45 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 57; Significance: 6e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 11 - 71
Target Start/End: Original strand, 3768172 - 3768232
Alignment:
| Q |
11 |
acctgtgtattttggtttttatgttaatttttttaactagtgtgtagaagataaaatgttt |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3768172 |
acctgtgtattttggtttttatgttaatttttataactagtgtgtagaagataaaatgttt |
3768232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 205 - 237
Target Start/End: Original strand, 3768415 - 3768447
Alignment:
| Q |
205 |
acgaagtggttgaaaacgaactgttgcacaggt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
3768415 |
acgaagtggttgaaaacgaactgttgcataggt |
3768447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University