View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_low_49 (Length: 230)
Name: NF12419_low_49
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_low_49 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 18 - 123
Target Start/End: Original strand, 35762904 - 35763009
Alignment:
| Q |
18 |
gttggaacaaaaacaagaacagaagaagcgttccgaggttgttcttgcttccacaagatatatccatacgcattgtacttgttttgtatttatagcacat |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35762904 |
gttggaacaaaaacaaggacagaagaagcgttccgaggttgttcttgcttccacaagatatatccatacgcattgtacttgttttgtatttatagcacat |
35763003 |
T |
 |
| Q |
118 |
gccaca |
123 |
Q |
| |
|
|||||| |
|
|
| T |
35763004 |
gccaca |
35763009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University