View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12419_low_52 (Length: 227)

Name: NF12419_low_52
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12419_low_52
NF12419_low_52
[»] chr1 (1 HSPs)
chr1 (18-213)||(35506471-35506666)


Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 35506666 - 35506471
Alignment:
18 aatcattgttttaaatctacattttcctttctggtttggtttggagtaatatgctgatttctgatttttctacttcttcaaagatttatgaagctgcagt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
35506666 aatcattgttttaaatctacattttcctttctggtttggtttggagtaatatgctcatttctgatttttctacttcttcaaagatttatgaagctgcagt 35506567  T
118 tagagggttggcccccgttgatagcccattgccagtcaaatttccgcttccagatccatcagatccgttttctctgaagccgggtcgtgtctctgc 213  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35506566 tagagggttggcccctgttgatagcccattgccagtcaaatttccgcttccagatccatcagatccgttttctctgaagccgggtcgtgtctctgc 35506471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University