View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_low_58 (Length: 208)
Name: NF12419_low_58
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 51482421 - 51482242
Alignment:
| Q |
19 |
tccacatatactcaaaattactgcttcaaaggtacagattggtatggatatgatgacactcaaagtatagctaacaaggttatttatgccaaacaaaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51482421 |
tccacatatactcaaaattactgcttcaaaggtacagattggtatggatatgatgacactcaaagtatagctaacaaggttatttatgccaaacaaaatg |
51482322 |
T |
 |
| Q |
119 |
gattgtttggatattttgcttggcatattgaacaagacagcaactgggctctttctgaagcaggtcagctcacaggttct |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
51482321 |
gattgtttggatattttgcttggcatattgaacaagacagcaactgggctctttctgaagcaggtcagctcataggttct |
51482242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 19 - 183
Target Start/End: Complemental strand, 51467511 - 51467347
Alignment:
| Q |
19 |
tccacatatactcaaaattactgcttcaaaggtacagattggtatggatatgatgacactcaaagtatagctaacaaggttatttatgccaaacaaaatg |
118 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||| ||||||||| ||||||| |
|
|
| T |
51467511 |
tccacatatgctcaaaattactgcttcaaaggtacagattggtatggatatgatgacactcagagtatatctgccaaggttgcttatgccaagcaaaatg |
51467412 |
T |
 |
| Q |
119 |
gattgtttggatattttgcttggcatattgaacaagacagcaactgggctctttctgaagcaggt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
51467411 |
gattgtttggatattttgcttggcatattgaacaagacaacaactgggctctttctcaagcaggt |
51467347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 34 - 183
Target Start/End: Complemental strand, 48423914 - 48423765
Alignment:
| Q |
34 |
aattactgcttcaaaggtacagattggtatggatatgatgacactcaaagtatagctaacaaggttatttatgccaaacaaaatggattgtttggatatt |
133 |
Q |
| |
|
||||| ||||||| ||| ||||||||||||||||| ||||||||||| |||||| || ||||||| |||||||| |||||||| ||||||||||||| |
|
|
| T |
48423914 |
aattattgcttcatagggacagattggtatggatacgatgacactcagagtatatctgccaaggttgactatgccaagcaaaatggtttgtttggatatt |
48423815 |
T |
 |
| Q |
134 |
ttgcttggcatattgaacaagacagcaactgggctctttctgaagcaggt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48423814 |
ttgcttggcatattgaacaagacagcaactgggctctttctcaagcaggt |
48423765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University