View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_low_59 (Length: 208)
Name: NF12419_low_59
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_low_59 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 5e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 12 - 126
Target Start/End: Complemental strand, 22770936 - 22770822
Alignment:
| Q |
12 |
acctgtggaatagaaatctttcaactgttagatcaatctatgcactttaacatccacatggacatcaaatatatgtgtttgttgaaattaaatttgtaat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||| |
|
|
| T |
22770936 |
acctgtggaatagaaatctttcaactgttagatcaatctatgcactttaacatccacatggacatcaaatatatgtttttcttgaaattaaacttgtaat |
22770837 |
T |
|
| Q |
112 |
agcatttttatgaaa |
126 |
Q |
| |
|
|||||||| |||||| |
|
|
| T |
22770836 |
agcattttcatgaaa |
22770822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 120 - 192
Target Start/End: Complemental strand, 22770667 - 22770595
Alignment:
| Q |
120 |
tatgaaacccattttattttagtaaagttacaatacagtacctattacggcattcttcaaatgacgatcattt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22770667 |
tatgaaacccattttattttagtaaagttacaatacagtacctattacggcattcttcaaatgacgatcattt |
22770595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University