View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12419_low_60 (Length: 207)
Name: NF12419_low_60
Description: NF12419
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12419_low_60 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 22 - 191
Target Start/End: Original strand, 42184055 - 42184224
Alignment:
| Q |
22 |
ttttgctatatctgtttagaatcacatgttttgattcatatcatatgagtttcatgaaatcaggttgccaatgtgattttgttgaaggcttaagcttcaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42184055 |
ttttgctatatctgtttagaatcacatgttttgattcatatcatatgagtttcatgaaatcaggttgccaatgtgattttgttgaaggcttaagcttcta |
42184154 |
T |
|
| Q |
122 |
agtatagcttttgctaaaatctgtggttcttctaaatttatcatgaatccaaacatgtactatgcctatg |
191 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42184155 |
agtatagcttttgctaaaatctgtgattcttctaaatttatcatgaatccaaacatgtactatgcctatg |
42184224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University