View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_high_19 (Length: 251)
Name: NF1241_high_19
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 8e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 155 - 246
Target Start/End: Original strand, 12559159 - 12559251
Alignment:
| Q |
155 |
ggaacacatacaagtttgaatttaggaaatt-gacgtcgttagtaattgatttagccatgtgaattggtgatttaagtggctgagggctgagg |
246 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12559159 |
ggaacacatacaagtttgagtttaggaaatttgacgccgttagtaattgatttagccatgtgaattggtgatttaagtggctgagggctgagg |
12559251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 12559023 - 12559092
Alignment:
| Q |
19 |
aaggaataacaattgtctacgtacgttaatcttagtttctgcatgttatcatagtttctgcttgttatat |
88 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12559023 |
aaggaataacaattgtctacttacgttaatcttagtttctgcatgttatcatagtttctgcttgttatat |
12559092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University