View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_low_12 (Length: 365)
Name: NF1241_low_12
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_low_12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 176 - 365
Target Start/End: Complemental strand, 12559499 - 12559306
Alignment:
| Q |
176 |
gttatatatcatgatgcaa----ggttgattctgagtggaattgccttttgagttttgactcaagaataaaaaacaaaatgatacattctctggtacaca |
271 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
12559499 |
gttatatatcatgatgcaattaaggttgattctgagtggaattgccttttgagttttgactcaaaaataaaaaacaagatgatacattctctggtacaca |
12559400 |
T |
 |
| Q |
272 |
gatcatgaatctaaaattcctaataatctctgcagaaatgttgaacttattaaagatctcatcaattcactttctattgttggagaatgaagcc |
365 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12559399 |
gatcatgaatctaaaattcctaataatctctgcagaaatgttgaacttattaaagatctcatcaattcactttctattgttggagaatgaagcc |
12559306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 273 - 332
Target Start/End: Original strand, 18124511 - 18124570
Alignment:
| Q |
273 |
atcatgaatctaaaattcctaataatctctgcagaaatgttgaacttattaaagatctca |
332 |
Q |
| |
|
|||||||||| ||||||||| |||||||| |||||||||||| ||| |||||||| |||| |
|
|
| T |
18124511 |
atcatgaatccaaaattcctgataatctcagcagaaatgttggactaattaaagagctca |
18124570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University