View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_low_19 (Length: 336)
Name: NF1241_low_19
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 105 - 260
Target Start/End: Complemental strand, 53146483 - 53146328
Alignment:
| Q |
105 |
agctggctgtcaatctgatcccattcccacgtcttcacttttttatggttgggtttgcacctctcacttctcgtgggtctcagcagtatgtatcccttac |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53146483 |
agctggctgtcaatctgatcccattcccacgtcttcacttttttatggttgggtttgcacctctcacttctcgtgggtctcagcagtatgtatcccttac |
53146384 |
T |
|
| Q |
205 |
tgtcccggaactgactcaacaaatgtgggacgccaagaatatgatctgtggtgctg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
53146383 |
tgtcccggaactgactcaacaaatgtgggacgccaagaatatgatgtgtgctgctg |
53146328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 105 - 260
Target Start/End: Original strand, 5532346 - 5532501
Alignment:
| Q |
105 |
agctggctgtcaatctgatcccattcccacgtcttcacttttttatggttgggtttgcacctctcacttctcgtgggtctcagcagtatgtatcccttac |
204 |
Q |
| |
|
|||| ||||| ||||| || |||||||| |||||||||||||| ||||| || ||||| ||| | ||||| ||||| || |||||||| | || | |
|
|
| T |
5532346 |
agcttgctgtgaatctcattccattcccgcgtcttcactttttcatggtgggatttgctcctttgacttcccgtggctcccagcagtacaggactctaag |
5532445 |
T |
|
| Q |
205 |
tgtcccggaactgactcaacaaatgtgggacgccaagaatatgatctgtggtgctg |
260 |
Q |
| |
|
|||||| || || ||||||||||||||||| |||||||| ||||| |||| ||||| |
|
|
| T |
5532446 |
tgtccctgagctcactcaacaaatgtgggatgccaagaacatgatgtgtgctgctg |
5532501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 105 - 165
Target Start/End: Complemental strand, 38177471 - 38177411
Alignment:
| Q |
105 |
agctggctgtcaatctgatcccattcccacgtcttcacttttttatggttgggtttgcacc |
165 |
Q |
| |
|
|||| |||||||| || ||||||||||| ||||| || || |||||||||||||||||||| |
|
|
| T |
38177471 |
agcttgctgtcaaccttatcccattccctcgtctccatttctttatggttgggtttgcacc |
38177411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 105 - 165
Target Start/End: Complemental strand, 11732327 - 11732267
Alignment:
| Q |
105 |
agctggctgtcaatctgatcccattcccacgtcttcacttttttatggttgggtttgcacc |
165 |
Q |
| |
|
|||| ||||||||||| ||||||||||| || || || || || ||||||||||||||||| |
|
|
| T |
11732327 |
agcttgctgtcaatcttatcccattccctcggctccatttcttcatggttgggtttgcacc |
11732267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University