View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_low_20 (Length: 320)
Name: NF1241_low_20
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 95 - 243
Target Start/End: Complemental strand, 36806650 - 36806502
Alignment:
| Q |
95 |
acacattcagcataaatagcctcaacaattcttggacttgccacttcccacccacttggacaaatacaatatttactcatcttcattgtttcatggtatg |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36806650 |
acacattcagcataaatagcctcaacaattcttggacttgccacttcccacccacttggacaaatacaatatttactcatcttcattgtttcatggtatg |
36806551 |
T |
|
| Q |
195 |
aaattttttctggaagtttttcataaactaacacatctttgcctttgtt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36806550 |
aaattttttctggaagtttttcataaactaacacatctttgtctttgtt |
36806502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 95 - 243
Target Start/End: Original strand, 36514577 - 36514725
Alignment:
| Q |
95 |
acacattcagcataaatagcctcaacaattcttggacttgccacttcccacccacttggacaaatacaatatttactcatcttcattgtttcatggtatg |
194 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36514577 |
acacattcagcataaattgcctcaacaattcttggacttgccacttcccacccacttggacaaatacaatatttactcatcttcatggtttcatggtatg |
36514676 |
T |
|
| Q |
195 |
aaattttttctggaagtttttcataaactaacacatctttgcctttgtt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36514677 |
aaattttttctggaagtttttcataaactaacacatctttgtctttgtt |
36514725 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University