View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1241_low_22 (Length: 303)
Name: NF1241_low_22
Description: NF1241
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1241_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 56 - 215
Target Start/End: Original strand, 30400236 - 30400395
Alignment:
| Q |
56 |
agggactgaaagggtttcattcttcttgtcttggaacatgttctggatctcaagacagtgataatgaggagcaggttgttccttaattttcataatgtta |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30400236 |
agggactgaaagggtttcattcttcttgtcttggaacatgttctggatctcatgacagtgataatgaggaacaggttgttccttaattttcataatgtta |
30400335 |
T |
 |
| Q |
156 |
ctgttttttcaactttttcttatctcgttatttcttcattatgcttataatgtgattgga |
215 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
30400336 |
ctgttttttcaactttttcttatcttgttatttcttcattatgcttataatttgattgga |
30400395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University